Ac on Chromosome 6
Chromosome 6 of maize showing the position of mapped Ac elements
Current Status (last updated 02/18/05). 5 mapped.
A number of seed stocks are currently available through the Maize Genetics CoOp. Contact Tom Brutnell (tpb8@cornell.edu) for further details.
Search the chromosome
6 Ac collection in any of the following ways:
1) Scroll down to
browse Ac elelments on chromosome 6. Ac listed by map position
north to south.
2) Click on bin numbers
listed below the map to jump to the first Ac in that bin.
3) Use the jump menus
below the map to go direct to data on a named Ac.
Ac-bti00226
Typical kernel variegation patterns observed in seed homozygous for Ac-bti00226 and the Ds reporter (Ac-bti00226/Ac-bti00226, r-sc:m3/r-sc:m3)
The flanking sequence of Ac-bti00226 was initially cloned from a ~4.1 kb band, isolated from a genomic digestion using EcoR1 and hybridized with a probe designed from the internal 900 bp EcoR1-HindIII fragment of Ac.
Insertion of the Ac element into the cloned sequence was confirmed through PCR verification, as well as through Southern blot verification. We highly recommend confirming the position of all Ac lines using both PCR and Southern blot verification prior to large scale mutagenesis (see Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.
Map position : 6.00 (IBM population)
Map coordinate at MaizeGDB
Seed in stock. Genbank Accession #: AY559177
Transposition frequency : 2.51%.Ac primer : 5' TCCCGCAAGTTAAATATGAAAATG 3'Flanking primer : 5' TTTTGCCTTTCATTTATTTCAGTT 3'
PCR primers will amplify a 700bp product from individuals carrying Ac:bti00226 but not parental (p-vv) DNA. (click for gel).
Ac-mon00038
Typical kernel variegation patterns observed in seed homozygous for Ac-mon00038 and the Ds reporter (Ac-mon00038/Ac-mon00038, r-sc:m3/r-sc:m3)
The flanking sequence of Ac-mon00038 was initially cloned from a ~6.2 kb band, isolated from a genomic digestion using EcoR1 and hybridized with a probe designed from the internal 900 bp EcoR1-HindIII fragment of Ac.
Insertion of the Ac element into the cloned sequence was confirmed through PCR verification, as well as through Southern blot verification. We highly recommend confirming the position of all Ac lines using both PCR and Southern blot verification prior to large scale mutagenesis (see Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.
Map position: 6.01/02 (IBM population)
Map coordinate at MaizeGDB
Position in GSS Assembly
Seed in stock. Genbank Accession #: AY559229
Back
to top
Ac-bti31132
The flanking sequence of Ac-bti31132 was initially cloned from a ~3.0 kb band, isolated from a genomic digestion using EcoR1 and hybridized with a probe designed from the internal 900 bp EcoR1-HindIII fragment of Ac.
Insertion of the Ac element into the cloned sequence was confirmed through PCR verification, as well as through Southern blot verification. We highly recommend confirming the position of all Ac lines using both PCR and Southern blot verification prior to large scale mutagenesis (see Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.
Map position: 6.04 (IBM population)
Map coordinate at MaizeGDB
Seed in stock. Genbank Accession #: NA
Ac-mon02901
Typical kernel variegation patterns observed in seed homozygous for Ac-mon02901 and the Ds reporter (Ac-mon02901/Ac-mon02901, r-sc:m3/r-sc:m3)
The flanking sequence of Ac-mon02901 was initially cloned from a ~3.2 kb band, isolated from a genomic digestion using EcoR1 and hybridized with a probe designed from the internal 900 bp EcoR1-HindIII fragment of Ac.
Insertion of the Ac element into the cloned sequence was confirmed through PCR verification, as well as through Southern blot verification. We highly recommend confirming the position of all Ac lines using both PCR and Southern blot verification prior to large scale mutagenesis (see Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.
Map position: 6.04 (IBM population)
Map coordinate at MaizeGDB
Seed in stock. Genbank Accession #: AY559179
Ac primer : 5' TCCCGCAAGTTAAATATGAAAATG 3'
Flanking primer : 5' GAGCGAAGTGGTGAATAATC GGT 3'
PCR primers will amplify a 550bp product from individuals carrying Ac:mon02901 but not parental (bti97156) DNA. (click for gel).
Ac-bti95076
Typical kernel variegation patterns observed in seed homozygous for Ac-bti95076 and the Ds reporter (Ac-bti95076/Ac-bti95076, r-sc:m3/r-sc:m3)
The flanking sequence of Ac-bti95076 was initially cloned from a ~3.0 kb band, isolated from a genomic digestion using EcoR1 and hybridized with a probe designed from the internal 900 bp EcoR1-HindIII fragment of Ac.
Insertion of the Ac element into the cloned sequence was confirmed through PCR verification, as well as through Southern blot verification. We highly recommend confirming the position of all Ac lines using both PCR and Southern blot verification prior to large scale mutagenesis (see Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.
Map position: 6.05 (IBM population)
Map coordinate at MaizeGDB
Seed in stock. Genbank Accession #: AY559207
Ac primer : 5' GTTAAATATGAAAATGAAAACGG 3'
Flanking primer : 5' CATTAAGCATTGTTGTAATGGC 3'
PCR primers will amplify a 602bp product from individuals carrying Ac:bti95076 but not parental (p-vv) DNA. (click for gel).