Ac-mon00192 PCR verification
Ac-mon00192 PCR
verification gel:
Lane 1 = 100 bp ladder
Lane 5 = Ac-bti97156
Lane 6 = W22
Lane 7 = Ac-mon00192.5
Lane 8 = Ac-mon00192.4
PCR verification primers:
Ac (700 5’end):
5’- TTTCCCATCCTACTTTCATCCCTG -3’
flanking (mon00192.F1): 5’-CACGGGCAACATGATTATCG -3’
Product size: 192 bp
PCR verification notes:
The DNA flanking the newly transposed Ac was cloned and sequenced from
one individual line. Verification PCR was performed using lines (lanes 7 &
8) that contained the newly transposed Ac element. An Ac-specific
primer was used with a gene-specific primer to amplify the fragment of 192 bp.
The absence of this Ac from the progenitor line results in the absence
of the PCR product (lanes 5 & 6). Detailed descriptions of Ac verification
can be found in Brutnell and Conrad, 2003, Methods in Molecular Biology, 236:157-76.